Journal: Theranostics

Article Title: PIM1 instigates endothelial-to-mesenchymal transition to aggravate atherosclerosis.

doi: 10.7150/thno.102597

Figure Lengend Snippet: Figure 8. NDRG1 and PTBP1 collaborate to promote EndMT. (A) The Nuclear and cytoplasm proteins of input, IgG and anti-His-Tag were purified and size fractionated on 10% SDS-PAGE. The gel was stained by coomassie brilliant blue staining. (B) The content of NDRG1 was analyzed by NDRG1 antibody. (C) The Co-IP experiment detecting the interaction between NDRG1 and PTBP1 in nucleus from HUVEC treated with H2O2 (200 μM) and TGF-β (50 ng/mL, 48 h). (D, E) Molecular simulations and protein docking of NDRG1 and PTBP1. (F) Schematic diagrams of 6*His-Tagged full-length (WT) NDRG1, and their various deletion mutants (180-294aa, and 326-394aa) (Top). HEK 293T cells were co-transfected with His-Tagged NDRG1 or its deletion mutants or vectors, and whole cell lysates were assessed by immunoprecipitation followed by immunoblotting with

Article Snippet: PIM1 protein (HY-P701745, MCE), PTBP1 protein (Ag28404, Proteintech), and small molecule Max-40279 (HY-145723, MCE; 500 nM) binding activities were generated with the SPR system, and the binding signal was exhibited by the response (RU) value.

Techniques: Purification, SDS Page, Staining, Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Western Blot

Journal: Neuron

Article Title: Selective neuronal vulnerability in Alzheimer’s disease: a network-based analysis

doi: 10.1016/j.neuron.2020.06.010

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Psy., 2018 RRID: NA Mouse: htau PAC: B6.Cg- Mapt tm1(EGFP)Klt Tg(MAPT)8cPdav/J Jackson lab IMSR Cat# JAX:005491, RRID:IMSR_JAX:005491 Oligonucleotides all mouse genotyping primers See Table S7 for sequences IDT-DNA, RRID : NA fluorescent PCR for human tau splicing - forward primer IDT-DNA HPLC purified 5’-IRDye 800 – CTCCAAAATCAGGGGATCGC – 3’, RRID: NA fluorescent PCR for human tau splicing - reverse primer IDT-DNA unlabeled 5’ –CCTTGCTCAGGTCAACTGGT – 3’, RRID: NA fluorescent PCR for mouse tau splicing - forward primer IDT-DNA HPLC purified 5’-IRDye 800 – CACCAAAATCCGGAGAACGA – 3’, RRID: NA fluorescent PCR for mouse tau splicing - reverse primer IDT-DNA unlabeled 5’ –CTTTGCTCAGGTCCACCGG – 3’, RRID: NA Recombinant DNA RP23–329L1 unmodified BAC CHORI RRID : NA RP23–181A2 unmodified BAC CHORI RRID : NA RP24–68J22 unmodified BAC CHORI RRID : NA RP23–307B16 unmodified BAC CHORI RRID : NA RP23–199D5 unmodified BAC CHORI RRID : NA RP24–344N1 unmodified BAC CHORI RRID : NA RP23–126C5 unmodified BAC CHORI RRID : NA RP23–329L1 - eGFP-L10a This paper Cacng5-bacTRAP - modified BAC , RRID : NA RP23–181A2 - eGFP-L10a This paper Calca-bacTRAP - modified BAC , RRID : NA RP24–68J22- eGFP-L10a This paper Cartpt - modified BAC , RRID : NA RP23–307B16 - eGFP-L10a This paper Sh3bgrl2-bacTRAP - modified BAC , RRID : NA RP23–199D5 - eGFP-L10a This paper Rasgrp2–199D5-bacTRAP - modified BAC, RRID : NA RP24–344N1 - eGFP-L10a This paper Rasgrp2–344N1-bacTRAP – modified BAC, RRID : NA RP23–126C5 - eGFP-L10a This paper Sstr4-bacTRAP - modified BAC , RRID : NA mouse Ptbp1 untagged cDNA clone {"type":"entrez-nucleotide","attrs":{"text":"NM_008956","term_id":"545687870"}} NM_008956 Origene Cat# {"type":"entrez-nucleotide","attrs":{"text":"MG223224","term_id":"1316024794"}} MG223224 , RRID : NA Software and Algorithms htseq Anders et al., 2015 https://github.com/htseq/htseq FIMO Grant et al., 2011 http://meme-suite.org/doc/fimo.html edgeR Robinson et al., 2010 http://bioconductor.org/packages/devel/bioc/html/edgeR.html The Sleipnir Library for Computational Functional Genomics Huttenhower et al., 2008 https://libsleipnir.bitbucket.io/ VEGAS2 Mishra and Macgregor, 2015 https://vegas2.qimrberghofer.edu.au/ STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Open in a separate window KEY RESOURCES TABLE

Techniques: Immunofluorescence, Plasmid Preparation, shRNA, Sequencing, Expressing, Functional Assay, Over Expression, Purification, Recombinant, Modification, BAC Assay, Software

Journal: bioRxiv

Article Title: Multilevel integrative transcriptome analyses in humans and humanized mice define in vivo human lncRNA metabolic regulators

doi: 10.1101/2020.01.01.884023

Figure Lengend Snippet: (A) RNA ploy II ChIP analyses in liver tissues of humanized mice receiving adenovirus for control (sh-lacZ, n=3) or knocking down of hLMR1 (sh-hLMR1, n=3). (B) Left: western blot analysis of PTBP1 in hLMR1 pulldown, right: expression of hLMR1 in PTBP1 RIP (RNA immunoprecipitation) in humanized liver. (C) HMGCS1 promoter-driven luciferase reporter assay in 293A cells (n=3 for each group). Data are representative results of three independent experiments. (D) PTBP1 ChIP analyses in liver tissues of humanized mice receiving adenovirus for control (sh-lacZ, n=3) or knocking down of hLMR1 (sh-hLMR1, n=3). Error bars represent SEM, * p<0.05.

Article Snippet: Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat: RC201779 and PS100001).

Techniques: Western Blot, Expressing, Immunoprecipitation, Luciferase, Reporter Assay

Journal: bioRxiv

Article Title: Multilevel integrative transcriptome analyses in humans and humanized mice define in vivo human lncRNA metabolic regulators

doi: 10.1101/2020.01.01.884023

Figure Lengend Snippet: (A) Gene expression in the liver of regular mice receiving lacZ shRNA (sh-lacZ, n=9), or shRNA for Ptbp1 (sh-Ptbp1, n=7). (B) Gene expression in the liver of regular mice receiving adenovirus for control (Ad-Vector, n=5) or expression of hLMR1 (Ad-hLMR1, n=6). (C) Plasma (left) and liver (right) cholesterol levels in regular mice receiving adenovirus for control (Ad-Vector, n=9) or expressing of hLMR1 (Ad-hLMR1, n=9). Error bars represent SEM, * p<0.05.

Article Snippet: Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat: RC201779 and PS100001).

Techniques: Expressing, shRNA, Plasmid Preparation

Journal: Nucleic Acids Research

Article Title: Characterization of gRNA-dependent and gRNA-independent off-target binding sites of PspCas13b and RfxCas13d in mammalian cells

doi: 10.1093/nar/gkag112

Figure Lengend Snippet: gRNA-dependent off-target binding alters the expression of essential genes and induces substantial alterations in cell proliferation. ( A – D ) RT-qPCR and western blot analyses of on-target EZH2 and three gRNA-dependent off-target genes bound by the PspCas13b-EZH2-g2 complex, with comparisons between non-targeting and EZH2-g2 targeting conditions. ( E – H ) RT-qPCR and western blot analyses of on-target EZH2 and three gRNA-dependent off-target genes bound by the RfxCas13d-EZH2-g2 complex, with comparisons between non-targeting and EZH2-g2 targeting conditions. RT-qPCR data are presented as mean ± SD ( n = 3). Relative changes in protein abundance were quantified by densitometric analysis and are indicated as red numbers at the bottom of each panel. ( I ) Proliferation of cells expressing PspCas13b (left panel) or RfxCas13d (right panel) with either targeting gRNAs or a non-targeting control gRNA (gNT), measured by CCK-8 assay. Proliferation rates were measured by absorbance at days 1–5 and normalized to that at day 1. Data are presented as mean ± SD ( n = 4). * P < 0.05; ** P < 0.01; *** P < 0.001. ns, not significant. ( J ) Apoptosis analysis of cells expressing PspCas13b (left panel) or RfxCas13d (right panel) with either targeting gRNAs or non-targeting control gRNA (gNT). Data are presented as mean ± SD ( n = 3). ns, not significant.

Article Snippet: The following antibodies were used for western blot analysis in this study: PTBP1 polyclonal antibody (Proteintech, 12582-1-AP), RHOA polyclonal antibody (Proteintech, 10749-1-AP), CTSH polyclonal antibody (Proteintech, 10315-1-AP), CDK19 polyclonal antibody (Proteintech, 13761-1-AP), HMGN2 polyclonal antibody (Proteintech, 10953-1-AP), ACVR2B antibody (Abmart, T58048 ), NUCKS1 polyclonal antibody (Proteintech, 12023-2-AP), HMGA1 polyclonal antibody (Proteintech, 29895-1-AP), EZH2 polyclonal antibody (Proteintech, 21800-1-AP), EFNA3 polyclonal antibody (Proteintech, 12480-1-AP), HPSE polyclonal antibody (Proteintech, 24529-1-AP), SPG7 polyclonal antibody (Proteintech, 27801-1-AP), TRAF3 polyclonal antibody (Proteintech, 18099-1-AP), MDK polyclonal antibody (Proteintech, 11009-1-AP), SCRN1 polyclonal antibody (Proteintech, 14303-1-AP), HA-Tag (26D11) mAb (Abmart, M20003L), GAPDH (3B3) mAb (Abmart, M20006L), ACSL1 polyclonal antibody (Proteintech, 13989-1-AP), FASN polyclonal antibody (Proteintech, 10624-2-AP), RPL14 polyclonal antibody (Proteintech, 14991-1-AP), ACOX1 polyclonal antibody (Proteintech, 10957-1-AP), ACO2 polyclonal antibody (Proteintech, 11134-1-AP), EIF2D polyclonal antibody (Proteintech, 12840-1-AP).

Techniques: Binding Assay, Expressing, Quantitative RT-PCR, Western Blot, Quantitative Proteomics, Control, CCK-8 Assay